SNU-761 Cells

Name: CLS Cell Lines Service GmbH
Address: Dr.-Eckener-Straße 8, Eppelheim, 69214, DE
Telephone: +496221405780
Price range: €€€

US$ 540,00*

Products are shipped frozen on dry ice in cryotubes. Each cryotube typically contains 3 × 10⁶ cells for adherent lines or 5 × 10⁶ cells for suspension lines (refer to the batch CoA for details).

Preços sem impostos, mais custos de envio

cryovial

Número do produto: 305637

Ficha de dados de segurança

Ficha técnica do produto

Certificado de Análise (CoA)

Descrição	The SNU-761 cell line is a human hepatocellular carcinoma (HCC) model derived from an adult patient. As part of the Cancer Cell Line Encyclopedia (CCLE) and LIMORE (Liver Cancer Model Repository) initiatives, SNU-761 has been extensively characterized at multiple molecular levels. The cell line has been used to explore the genetic and transcriptomic heterogeneity typical of primary liver cancers, including those associated with hepatitis B virus (HBV) infection, which is prevalent in many East Asian HCC cases. Genomic profiling has revealed that LIMORE models such as SNU-761 often retain the mutational and copy number alteration landscapes of primary tumors, including alterations in key oncogenic drivers like TP53, CTNNB1, and FGF19. SNU-761 and other liver cancer models in the LIMORE collection have undergone high-throughput drug sensitivity screening across a wide panel of chemotherapeutics and targeted agents. These pharmacogenomic datasets have allowed researchers to identify potential biomarkers predictive of response, such as gene-drug associations and synthetic lethalities relevant to common mutations in liver cancer. Furthermore, comparisons of transcriptomic and epigenetic data—such as DNA methylation and histone modification patterns—have helped classify SNU-761 within liver cancer subtypes and assess its functional attributes, including invasiveness and response to pathway-specific inhibitors. This extensive profiling makes SNU-761 a valuable model for studying HBV-related HCC and evaluating personalized therapeutic strategies.
Organismo	Human
Tecido	Liver
Doença	hepatocellular carcinoma
Sinônimos	SNU761, NCI-SNU-761

Idade	49 years
Gênero	Male
Etnia	Korean
Morfologia	Polygonal
Tipo de célula	Epithelial
Propriedades de crescimento	Adherent, monolayer

Referência	SNU-761 (Cytion catalog number 305637)
Nível de biossegurança	2
NCBI_TaxID	9606
Número de acesso do Cellosaurus	CVCL_5089

Perfil mutacional	Mutation: TP53, Simple, p.Ser313Glyfs*13 (c.937_968delAGCTCCTCTCCCCAGCCAAAGAAGAAACCACT), Unspecified

Meio de cultura	RPMI 1640, w: 2.0 mM stable Glutamine, w: 2.0 g/L NaHCO3 (Cytion article number 820700a)
Suplementos	Supplement the medium with 10% heat-inactivated FBS, add 2.5 g/L glucose and 10 mM HEPES
Reagente de dissociação	Accutase
Tempo de duplicação	24 hours
Subcultura	Remove medium, add fresh 0.25 % trypsin 0.02 % EDTA solution, stand culture flask at 37''''C for 3 to 5 minutes, add culture medium and collect the cells, transfer the medium into 15ml tube, centrifuge, aspirate the medium, resuspend the pellets with culture medium and dispense into the culture flask
Densidade de semeadura	1 to 3 x 10⁴ cells/cm²
Renovação de fluidos	2 to 3 times per week
Meio de congelamento	As a cryopreservation medium, we use complete growth medium (including FBS) + 10% DMSO for adequate post-thaw viability, or CM-1 (Cytion catalog number 800100), which includes optimized osmoprotectants and metabolic stabilizers to enhance recovery and reduce cryo-induced stress.
Descongelamento e cultura de células	Confirm that the vial remains deeply frozen upon delivery, as cells are shipped on dry ice to maintain optimal temperatures during transit. Upon receipt, either store the cryovial immediately at temperatures below -150°C to ensure the preservation of cellular integrity, or proceed to step 3 if immediate culturing is required. For immediate culturing, swiftly thaw the vial by immersing it in a 37°C water bath with clean water and an antimicrobial agent, agitating gently for 40-60 seconds until a small ice clump remains. Perform all subsequent steps under sterile conditions in a flow hood, disinfecting the cryovial with 70% ethanol before opening. Carefully open the disinfected vial and transfer the cell suspension into a 15 ml centrifuge tube containing 8 ml of room-temperature culture medium, mixing gently. Centrifuge the mixture at 300 x g for 3 minutes to separate the cells and carefully discard the supernatant containing residual freezing medium. Gently resuspend the cell pellet in 10 ml of fresh culture medium. For adherent cells, divide the suspension between two T25 culture flasks; for suspension cultures, transfer all the medium into one T25 flask to promote effective cell interaction and growth. Adhere to established subculture protocols for continued growth and maintenance of the cell line, ensuring reliable experimental outcomes.
Atmosfera de incubação	37°C, 5% CO₂, humidified atmosphere.
Condições de envio	Cryopreserved cell lines are shipped on dry ice in validated, insulated packaging with sufficient refrigerant to maintain approximately −78 °C throughout transit. On receipt, inspect the container immediately and transfer vials without delay to appropriate storage.
Condições de armazenamento	For long-term preservation, place vials in vapor-phase liquid nitrogen at about −150 to −196 °C. Storage at −80 °C is acceptable only as a short interim step before transfer to liquid nitrogen.

Esterilidade	Mycoplasma contamination is excluded using both PCR-based assays and luminescence-based mycoplasma detection methods. To ensure there is no bacterial, fungal, or yeast contamination, cell cultures are subjected to daily visual inspections.

Número do lote	Tipo de certificado	Data	Número de catálogo
305637-200426	Certificado de Análise	22. May. 2026	305637

SNU-761 Cells

Informações gerais

Características

Dados regulatórios

Dados biomoleculares

Manuseio

Controle de Qualidade e Análise Molecular

Certificado de Análise (CoA)