MM.1S Cells
US$ 395,00*
Products are shipped frozen on dry ice in cryotubes. Each cryotube typically contains 3 × 106 cells for adherent lines or 5 × 106 cells for suspension lines (refer to the batch CoA for details).
Informações gerais
| Descrição | The MM.1S cell line is part of the MM.1 series, which was developed from a single patient with multiple myeloma (MM) to study various stages of disease progression and response to glucocorticoid (GC) therapy. MM.1S is specifically sensitive to glucocorticoids, such as dexamethasone, and serves as a model to investigate the mechanisms of GC-induced apoptosis in multiple myeloma cells. This sensitivity makes MM.1S a crucial tool for studying the early phases of MM treatment and the cellular pathways leading to GC responsiveness. MM.1S cells, like other MM.1 lines, exhibit typical myeloma morphology, including round cells with eccentrically located nuclei, many of which are binucleated or multinucleated. These cells express characteristic markers of plasma cells, such as CD38 and PCA-1, while lacking typical B-cell markers like CD19 and CD20, reflecting their terminally differentiated status as plasma cells. They also exhibit high levels of immunoglobulin lambda (λ) light chain expression, consistent with their origin. This cell line has been vital for exploring pathways of drug action, resistance, and apoptosis in MM, especially in the context of GC treatment. One of the key features of MM.1S is its reliance on functional glucocorticoid receptors (GR) for drug responsiveness. In MM.1S, high levels of wild-type GR enable dexamethasone to induce apoptosis effectively, providing a valuable system for studying the molecular events underlying this process. This line is often compared to its resistant counterpart, MM.1R, to investigate the mechanisms of GC resistance, a critical issue in the treatment of MM. Together, the MM.1S cell line offers insights into drug sensitivity, disease progression, and potential therapeutic strategies for multiple myeloma. |
|---|---|
| Organismo | Human |
| Tecido | Peripheral blood |
| Doença | Multiple myeloma |
| Sinônimos | MM1.S, MM1-S, MM-1S, MM1S |
Características
| Idade | 45 years |
|---|---|
| Gênero | Female |
| Etnia | African American |
| Morfologia | Lymphoblast |
| Tipo de célula | B cell |
| Propriedades de crescimento | Mixed: loosely attached monolayer and suspension |
Dados regulatórios
| Referência | MM.1S (Cytion catalog number 305304) |
|---|---|
| Nível de biossegurança | 1 |
| NCBI_TaxID | 9606 |
| Número de acesso do Cellosaurus | CVCL_8792 |
Dados biomoleculares
| Produtos | IgA lambda |
|---|---|
| Perfil mutacional | Mutation: KRAS, p.Gly12Ala (c.35G>C), heterozygous; Mutation: TRAF3, p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA), homozygous |
Manuseio
| Meio de cultura | RPMI 1640, w: 2.0 mM stable Glutamine, w: 2.0 g/L NaHCO3 (Cytion article number 820700a) |
|---|---|
| Suplementos | Supplement the medium with 10% heat-inactivated FBS |
| Reagente de dissociação | Accutase |
| Subcultura | Gather the suspension cells in a 15 ml tube and gently wash the adherent cells with PBS lacking calcium and magnesium (use 3-5 ml for T25 flasks and 5-10 ml for T75 flasks). Apply Accutase (1-2 ml for T25 flasks, 2.5 ml for T75 flasks) ensuring full coverage of the cell layer. Allow the cells to incubate at room temperature for 10 minutes. Following incubation, combine and centrifuge both the suspension and adherent cells. After centrifugation, carefully resuspend the cell pellet and transfer the cell suspension into new flasks containing fresh medium. |
| Meio de congelamento | As a cryopreservation medium, we use complete growth medium (including FBS) + 10% DMSO for adequate post-thaw viability, or CM-1 (Cytion catalog number 800100), which includes optimized osmoprotectants and metabolic stabilizers to enhance recovery and reduce cryo-induced stress. |
| Descongelamento e cultura de células |
|
| Atmosfera de incubação | 37°C, 5% CO2, humidified atmosphere. |
| Condições de envio | Cryopreserved cell lines are shipped on dry ice in validated, insulated packaging with sufficient refrigerant to maintain approximately −78 °C throughout transit. On receipt, inspect the container immediately and transfer vials without delay to appropriate storage. |
| Condições de armazenamento | For long-term preservation, place vials in vapor-phase liquid nitrogen at about −150 to −196 °C. Storage at −80 °C is acceptable only as a short interim step before transfer to liquid nitrogen. |
Controle de Qualidade e Análise Molecular
| Esterilidade | Mycoplasma contamination is excluded using both PCR-based assays and luminescence-based mycoplasma detection methods. To ensure there is no bacterial, fungal, or yeast contamination, cell cultures are subjected to daily visual inspections. |
|---|
Certificado de Análise (CoA)
| Número do lote | Tipo de certificado | Data | Número de catálogo |
|---|---|---|---|
| 305304-160924 | Certificado de Análise | 23. May. 2025 | 305304 |
| 305304-280225 | Certificado de Análise | 23. May. 2025 | 305304 |