SNU-761 Cells

Name: CLS Cell Lines Service GmbH
Address: Dr.-Eckener-Straße 8, Eppelheim, 69214, DE
Telephone: +496221405780
Price range: €€€

759,00 CAD$*

Products are shipped frozen on dry ice in cryotubes. Each cryotube typically contains 3 × 10⁶ cells for adherent lines or 5 × 10⁶ cells for suspension lines (refer to the batch CoA for details).

Prix hors taxes, frais de livraison en sus

cryovial

Numéro de produit : 305637

Fiche signalétique

Fiche de produit

Certificat d'analyse (CoA)

Description	The SNU-761 cell line is a human hepatocellular carcinoma (HCC) model derived from an adult patient. As part of the Cancer Cell Line Encyclopedia (CCLE) and LIMORE (Liver Cancer Model Repository) initiatives, SNU-761 has been extensively characterized at multiple molecular levels. The cell line has been used to explore the genetic and transcriptomic heterogeneity typical of primary liver cancers, including those associated with hepatitis B virus (HBV) infection, which is prevalent in many East Asian HCC cases. Genomic profiling has revealed that LIMORE models such as SNU-761 often retain the mutational and copy number alteration landscapes of primary tumors, including alterations in key oncogenic drivers like TP53, CTNNB1, and FGF19. SNU-761 and other liver cancer models in the LIMORE collection have undergone high-throughput drug sensitivity screening across a wide panel of chemotherapeutics and targeted agents. These pharmacogenomic datasets have allowed researchers to identify potential biomarkers predictive of response, such as gene-drug associations and synthetic lethalities relevant to common mutations in liver cancer. Furthermore, comparisons of transcriptomic and epigenetic data—such as DNA methylation and histone modification patterns—have helped classify SNU-761 within liver cancer subtypes and assess its functional attributes, including invasiveness and response to pathway-specific inhibitors. This extensive profiling makes SNU-761 a valuable model for studying HBV-related HCC and evaluating personalized therapeutic strategies.
Organisme	Human
Tissu	Liver
Maladie	hepatocellular carcinoma
Synonymes	SNU761, NCI-SNU-761

Âge	49 years
Genre	Male
Origine ethnique	Korean
Morphologie	Polygonal
Type de cellule	Epithelial
Propriétés de croissance	Adherent, monolayer

Référence	SNU-761 (Cytion catalog number 305637)
Niveau de biosécurité	2
NCBI_Numéro d'identification fiscale	9606
Cellosaurus - Numéro d'enregistrement	CVCL_5089

Profil mutationnel	Mutation: TP53, Simple, p.Ser313Glyfs*13 (c.937_968delAGCTCCTCTCCCCAGCCAAAGAAGAAACCACT), Unspecified

Milieu de culture	RPMI 1640, w: 2.0 mM stable Glutamine, w: 2.0 g/L NaHCO3 (Cytion article number 820700a)
Suppléments	Supplement the medium with 10% heat-inactivated FBS, add 2.5 g/L glucose and 10 mM HEPES
Réactif de dissociation	Accutase
Temps de doublement	24 hours
Repiquage	Remove medium, add fresh 0.25 % trypsin 0.02 % EDTA solution, stand culture flask at 37''''C for 3 to 5 minutes, add culture medium and collect the cells, transfer the medium into 15ml tube, centrifuge, aspirate the medium, resuspend the pellets with culture medium and dispense into the culture flask
Densité de semis	1 to 3 x 10⁴ cells/cm²
Renouvellement des fluides	2 to 3 times per week
Milieu de congélation	As a cryopreservation medium, we use complete growth medium (including FBS) + 10% DMSO for adequate post-thaw viability, or CM-1 (Cytion catalog number 800100), which includes optimized osmoprotectants and metabolic stabilizers to enhance recovery and reduce cryo-induced stress.
Décongélation et culture des cellules	Confirm that the vial remains deeply frozen upon delivery, as cells are shipped on dry ice to maintain optimal temperatures during transit. Upon receipt, either store the cryovial immediately at temperatures below -150°C to ensure the preservation of cellular integrity, or proceed to step 3 if immediate culturing is required. For immediate culturing, swiftly thaw the vial by immersing it in a 37°C water bath with clean water and an antimicrobial agent, agitating gently for 40-60 seconds until a small ice clump remains. Perform all subsequent steps under sterile conditions in a flow hood, disinfecting the cryovial with 70% ethanol before opening. Carefully open the disinfected vial and transfer the cell suspension into a 15 ml centrifuge tube containing 8 ml of room-temperature culture medium, mixing gently. Centrifuge the mixture at 300 x g for 3 minutes to separate the cells and carefully discard the supernatant containing residual freezing medium. Gently resuspend the cell pellet in 10 ml of fresh culture medium. For adherent cells, divide the suspension between two T25 culture flasks; for suspension cultures, transfer all the medium into one T25 flask to promote effective cell interaction and growth. Adhere to established subculture protocols for continued growth and maintenance of the cell line, ensuring reliable experimental outcomes.
Atmosphère d'incubation	37°C, 5% CO₂, humidified atmosphere.
Conditions d'expédition	Cryopreserved cell lines are shipped on dry ice in validated, insulated packaging with sufficient refrigerant to maintain approximately −78 °C throughout transit. On receipt, inspect the container immediately and transfer vials without delay to appropriate storage.
Conditions d'entreposage	For long-term preservation, place vials in vapor-phase liquid nitrogen at about −150 to −196 °C. Storage at −80 °C is acceptable only as a short interim step before transfer to liquid nitrogen.

Stérilité	Mycoplasma contamination is excluded using both PCR-based assays and luminescence-based mycoplasma detection methods. To ensure there is no bacterial, fungal, or yeast contamination, cell cultures are subjected to daily visual inspections.

Numéro de lot	Type de certificat	Date	Numéro de catalogue
305637-200426	Certificat d'analyse	22. May. 2026	305637

SNU-761 Cells

Renseignements généraux

Caractéristiques

Données réglementaires

Données biomoléculaires

Manipulation

Contrôle de la qualité et analyse moléculaire

Certificat d'analyse (CoA)