SNU-761 Cells
USD$540.00*
Products are shipped frozen on dry ice in cryotubes. Each cryotube typically contains 3 × 106 cells for adherent lines or 5 × 106 cells for suspension lines (refer to the batch CoA for details).
General information
| Description | The SNU-761 cell line is a human hepatocellular carcinoma (HCC) model derived from an adult patient. As part of the Cancer Cell Line Encyclopedia (CCLE) and LIMORE (Liver Cancer Model Repository) initiatives, SNU-761 has been extensively characterized at multiple molecular levels. The cell line has been used to explore the genetic and transcriptomic heterogeneity typical of primary liver cancers, including those associated with hepatitis B virus (HBV) infection, which is prevalent in many East Asian HCC cases. Genomic profiling has revealed that LIMORE models such as SNU-761 often retain the mutational and copy number alteration landscapes of primary tumors, including alterations in key oncogenic drivers like TP53, CTNNB1, and FGF19. SNU-761 and other liver cancer models in the LIMORE collection have undergone high-throughput drug sensitivity screening across a wide panel of chemotherapeutics and targeted agents. These pharmacogenomic datasets have allowed researchers to identify potential biomarkers predictive of response, such as gene-drug associations and synthetic lethalities relevant to common mutations in liver cancer. Furthermore, comparisons of transcriptomic and epigenetic data—such as DNA methylation and histone modification patterns—have helped classify SNU-761 within liver cancer subtypes and assess its functional attributes, including invasiveness and response to pathway-specific inhibitors. This extensive profiling makes SNU-761 a valuable model for studying HBV-related HCC and evaluating personalized therapeutic strategies. |
|---|---|
| Organism | Human |
| Tissue | Liver |
| Disease | hepatocellular carcinoma |
| Synonyms | SNU761, NCI-SNU-761 |
Characteristics
| Age | 49 years |
|---|---|
| Gender | Male |
| Ethnicity | Korean |
| Morphology | Polygonal |
| Cell type | Epithelial |
| Growth properties | Adherent, monolayer |
Regulatory Data
| Citation | SNU-761 (Cytion catalog number 305637) |
|---|---|
| Biosafety level | 2 |
| NCBI_TaxID | 9606 |
| CellosaurusAccession | CVCL_5089 |
Biomolecular Data
| Mutational profile | Mutation: TP53, Simple, p.Ser313Glyfs*13 (c.937_968delAGCTCCTCTCCCCAGCCAAAGAAGAAACCACT), Unspecified |
|---|
Handling
| Culture Medium | RPMI 1640, w: 2.0 mM stable Glutamine, w: 2.0 g/L NaHCO3 (Cytion article number 820700a) |
|---|---|
| Supplements | Supplement the medium with 10% heat-inactivated FBS, add 2.5 g/L glucose and 10 mM HEPES |
| Dissociation Reagent | Accutase |
| Doubling time | 24 hours |
| Subculturing | Remove medium, add fresh 0.25 % trypsin 0.02 % EDTA solution, stand culture flask at 37''''C for 3 to 5 minutes, add culture medium and collect the cells, transfer the medium into 15ml tube, centrifuge, aspirate the medium, resuspend the pellets with culture medium and dispense into the culture flask |
| Seeding density | 1 to 3 x 104 cells/cm2 |
| Fluid renewal | 2 to 3 times per week |
| Freeze medium | As a cryopreservation medium, we use complete growth medium (including FBS) + 10% DMSO for adequate post-thaw viability, or CM-1 (Cytion catalog number 800100), which includes optimized osmoprotectants and metabolic stabilizers to enhance recovery and reduce cryo-induced stress. |
| Thawing and Culturing Cells |
|
| Incubation Atmosphere | 37°C, 5% CO2, humidified atmosphere. |
| Shipping Conditions | Cryopreserved cell lines are shipped on dry ice in validated, insulated packaging with sufficient refrigerant to maintain approximately −78 °C throughout transit. On receipt, inspect the container immediately and transfer vials without delay to appropriate storage. |
| Storage Conditions | For long-term preservation, place vials in vapor-phase liquid nitrogen at about −150 to −196 °C. Storage at −80 °C is acceptable only as a short interim step before transfer to liquid nitrogen. |
Quality Control & Molecular Analysis
| Sterility | Mycoplasma contamination is excluded using both PCR-based assays and luminescence-based mycoplasma detection methods. To ensure there is no bacterial, fungal, or yeast contamination, cell cultures are subjected to daily visual inspections. |
|---|
Certificate of Analysis (CoA)
| Lot Number | Certificate Type | Date | Catalog Number |
|---|---|---|---|
| 305637-200426 | Certificate of Analysis | 22. May. 2026 | 305637 |
-
Related products
Related products
SNU-601 CellsOrganism Human Tissue Stomach Disease Gastric signet ring cell adenocarcinoma USD$550.00*