MM.1S-Luc cells
USD$800.00*
Products are shipped frozen on dry ice in cryotubes. Each cryotube typically contains 3 × 106 cells for adherent lines or 5 × 106 cells for suspension lines (refer to the batch CoA for details).
General information
| Description | MM.1S-Luc is a genetically modified derivative of the human multiple myeloma cell line MM.1S. This engineered variant stably expresses firefly luciferase (Luc), making it suitable for in vivo bioluminescent imaging and preclinical screening applications. The parental MM.1S line, derived from a patient with multiple myeloma, is characterized by its sensitivity to glucocorticoids and is commonly used in preclinical research focused on hematologic malignancies, particularly those involving plasma cell dyscrasias. The incorporation of luciferase enables non-invasive bioluminescent imaging, allowing researchers to monitor tumor burden and progression dynamically in live animal models. This is particularly advantageous in xenograft studies, where MM.1S-Luc can be used to evaluate therapeutic efficacy, tumor engraftment kinetics, and metastasis, providing a platform for quantifying tumor cells under varying experimental conditions. |
|---|---|
| Organism | Human |
| Tissue | Peripheral blood |
| Disease | Plasma cell myeloma |
| Synonyms | Luciferase Reporter MM.1S Cell Line |
Characteristics
| Age | 45 years |
|---|---|
| Gender | Female |
| Ethnicity | African American |
| Growth properties | Adherent/Suspension |
Regulatory Data
| Citation | MM.1S-Luc (Cytion catalog number 305829) |
|---|---|
| Biosafety level | 1 |
| NCBI_TaxID | 9606 |
| CellosaurusAccession | CVCL_E3I2 |
| GMO Status | GMO-S1: This cell line contains a stably integrated firefly luciferase reporter cassette (Luc2, codon-optimized) introduced via replication-incompetent lentiviral transduction. The resulting polyclonal cell population was maintained under puromycin selection (1–5 µg/mL). S1 containment is required. This classification applies only within Germany and may differ elsewhere. |
Biomolecular Data
| Antigen expression | Luc2 (firefly, codon-optimized) |
|---|---|
| Mutational profile | Mutation: KRAS, Simple, p.Gly12Ala (c.35G>C), Heterozygous (from parent cell line).Mutation, TRAF3, Simple, p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA), Homozygous (from parent cell line). |
Handling
| Culture Medium | Ham's F12K Medium, w: 2.0 mM L-Glutamine, w: 2.0 mM Sodium pyruvate, w: 2.5 g/L NaHCO3 (Cytion article number 820608a) |
|---|---|
| Supplements | Supplement the medium with 10% FBS |
| Dissociation Reagent | Accutase |
| Seeding density | 3-5*10^5/ml |
| Freeze medium | As a cryopreservation medium, we use complete growth medium (including FBS) + 10% DMSO for adequate post-thaw viability, or CM-1 (Cytion catalog number 800100), which includes optimized osmoprotectants and metabolic stabilizers to enhance recovery and reduce cryo-induced stress. |
| Thawing and Culturing Cells |
|
| Incubation Atmosphere | 37°C, 5% CO2, humidified atmosphere. |
| Shipping Conditions | Cryopreserved cell lines are shipped on dry ice in validated, insulated packaging with sufficient refrigerant to maintain approximately −78 °C throughout transit. On receipt, inspect the container immediately and transfer vials without delay to appropriate storage. |
| Storage Conditions | For long-term preservation, place vials in vapor-phase liquid nitrogen at about −150 to −196 °C. Storage at −80 °C is acceptable only as a short interim step before transfer to liquid nitrogen. |
Quality Control & Molecular Analysis
| Sterility | Mycoplasma contamination is excluded using both PCR-based assays and luminescence-based mycoplasma detection methods. To ensure there is no bacterial, fungal, or yeast contamination, cell cultures are subjected to daily visual inspections. |
|---|
| Variants: | Luciferase |
|---|
Certificate of Analysis (CoA)
| Lot Number | Certificate Type | Date | Catalog Number |
|---|---|---|---|
| 305829-220526 | Certificate of Analysis | 30. Jul. 2026 | 305829 |