MM.1R Cells
USD$375.00*
Products are shipped frozen on dry ice in cryotubes. Each cryotube typically contains 3 × 106 cells for adherent lines or 5 × 106 cells for suspension lines (refer to the batch CoA for details).
General information
| Description | The MM1.R cell line is a derivative of the MM1 cell line, originally established from a patient with multiple myeloma (MM). MM1.R was specifically developed to study resistance to dexamethasone, a corticosteroid used in the treatment of MM. The cell line provides a robust model for exploring mechanisms of glucocorticoid resistance and testing potential therapeutic strategies to overcome this challenge in MM treatment. Like MM1.S, MM1.R cells are characterized by high expression of interleukin-6 (IL-6)-dependent signaling pathways, which are pivotal in MM biology. However, MM1.R differs significantly in its resistance profile, making it a key tool for studying disease progression and drug resistance mechanisms. MM1.R cells exhibit transcriptional and signaling alterations compared to MM1.S, including differences in glucocorticoid receptor activity and NF-kB pathway modulation. The resistance phenotype has been linked to aberrations in apoptotic pathways, with a noted decrease in pro-apoptotic signaling upon treatment with dexamethasone. Importantly, studies on MM1.R have highlighted the role of these pathways in therapeutic resistance, paving the way for novel approaches targeting the microenvironment and cellular signaling dependencies in MM. MM1.R's utility extends beyond the study of dexamethasone resistance. It is a valuable model for evaluating combination therapies, including proteasome inhibitors and immunomodulatory drugs. The cell line's well-documented genetic and molecular landscape, including its response to various pharmacological agents, makes it an indispensable tool for preclinical MM research. Further transcriptomic studies on MM1.R have revealed that while it retains some similarity to patient-derived tumor profiles, its resistance mechanisms highlight critical deviations from non-resistant MM models, underscoring its relevance in therapeutic development. |
|---|---|
| Organism | Human |
| Tissue | Peripheral blood |
| Disease | Multiple myeloma |
| Synonyms | MM1.r, MM.1R, MM1-R, MM-1R, MM1R, MM1.R(L), MM1.RL |
Characteristics
| Age | 45 years |
|---|---|
| Gender | Female |
| Ethnicity | African American |
| Morphology | Lymphoblast-like |
| Cell type | B cell |
| Growth properties | Adherent/suspension |
Regulatory Data
| Citation | MM.1R (Cytion catalog number 305435) |
|---|---|
| Biosafety level | 1 |
| NCBI_TaxID | 9606 |
| CellosaurusAccession | CVCL_8794 |
Biomolecular Data
| Receptors expressed | Glucocorticoid receptor, not expressed |
|---|---|
| Protein expression | IgA lambda |
| Antigen expression | CD25-, CD38+, CD52+, CD59+ |
| Mutational profile | Mutation: TRAF3, p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA), homozygous |
Handling
| Culture Medium | RPMI 1640, w: 2.0 mM stable Glutamine, w: 2.0 g/L NaHCO3 (Cytion article number 820700a) |
|---|---|
| Supplements | Supplement the medium with 10% FBS |
| Dissociation Reagent | Accutase |
| Seeding density | 4-5*10^5/ml |
| Freeze medium | As a cryopreservation medium, we use complete growth medium (including FBS) + 10% DMSO for adequate post-thaw viability, or CM-1 (Cytion catalog number 800100), which includes optimized osmoprotectants and metabolic stabilizers to enhance recovery and reduce cryo-induced stress. |
| Thawing and Culturing Cells |
|
| Incubation Atmosphere | 37°C, 5% CO2, humidified atmosphere. |
| Shipping Conditions | Cryopreserved cell lines are shipped on dry ice in validated, insulated packaging with sufficient refrigerant to maintain approximately −78 °C throughout transit. On receipt, inspect the container immediately and transfer vials without delay to appropriate storage. |
| Storage Conditions | For long-term preservation, place vials in vapor-phase liquid nitrogen at about −150 to −196 °C. Storage at −80 °C is acceptable only as a short interim step before transfer to liquid nitrogen. |
Quality Control & Molecular Analysis
| Sterility | Mycoplasma contamination is excluded using both PCR-based assays and luminescence-based mycoplasma detection methods. To ensure there is no bacterial, fungal, or yeast contamination, cell cultures are subjected to daily visual inspections. |
|---|
Certificate of Analysis (CoA)
| Lot Number | Certificate Type | Date | Catalog Number |
|---|---|---|---|
| 305435-030726 | Certificate of Analysis | 13. Aug. 2026 | 305435 |